If you have been reading about BDNF expression and want a single page that covers the useful parts, this is it: definitions, context, how it is studied, and the questions that come up repeatedly.
Updated 2026-07-27. Numbers and descriptions here follow the published literature rather than marketing material.
The C-terminal Pro-Gly-Pro extension is not incidental. Proline-rich tails are known to resist several common peptidases, and the published literature attributes the longer half-life of Semax, relative to unmodified ACTH fragments, to this feature. The modification also removes the melanocyte-stimulating and corticosteroidogenic activity that characterizes longer ACTH-derived sequences. Because the molecule is small and hydrophilic, it is typically formulated as an aqueous solution for intranasal or parenteral delivery. Acetylation or amidation at the termini appears in closely related research peptides and shifts the mass by a fixed increment.
Reported pharmacological work centers on neurotrophic signaling, including changes in BDNF and NGF expression in hippocampal tissue in animal models. Human data come largely from studies conducted in Russia, and how well those results generalize to other populations remains an open question. Regulatory status differs sharply by jurisdiction: Semax is a registered prescription medicine in Russia, while it holds no approved marketing status in the United States or the European Union. Outside such jurisdictions it is generally handled as a research chemical, which affects both documentation and quality expectations.
Circulation time for the peptide is short because peptidases cleave it readily. The Pro-Gly-Pro tail is thought to slow breakdown compared with the bare ACTH fragment, but the gain appears modest. Absorption after intranasal dosing is limited, and only a fraction of a dose is expected to reach the central nervous system. Laboratory concentrations therefore sit well above levels achieved systemically, a gap that complicates translation from bench findings to clinical claims.
The mechanisms attributed to semax are inferred from animal and cell studies rather than traced to one confirmed target. The most frequently cited pathway involves increased expression of brain-derived neurotrophic factor and nerve growth factor in hippocampal and cortical tissue. Some work points to engagement of melanocortin receptors, particularly MC4, which the parent ACTH fragment can activate. Effects on dopaminergic and serotonergic signalling have also been reported. No single account explains all observed results, and the relative weight of each pathway remains unsettled.
| Property | Value | Notes |
|---|---|---|
| Molecular weight | ~813.9 Da (free heptapeptide) | N-acetylated form is about 42 Da heavier |
| Residue count | 7 (heptapeptide) | Four residues from ACTH(4-10), three added |
| Appearance | White to off-white powder | Usually supplied lyophilized |
| Solubility class | Freely soluble in water | Also dissolves in DMSO and polar organic solvents |
| Related parent fragment | ACTH(4-10) | Parent motif is Met-Glu-His-Phe |
Laboratory descriptions of the material are consistent across suppliers. It appears as a white to off-white lyophilized powder that dissolves readily in water and in polar organic solvents such as dimethyl sulfoxide. Aqueous solutions are clear and colorless at low concentrations. Because the peptide contains methionine, oxidation at the sulfur atom is a recognized degradation pathway, and handling notes usually call for protected, desiccated storage. Reported purity for research-grade lots is generally above 95 percent as measured by reversed-phase high-performance liquid chromatography.
The compound is registered in Russia as a pharmaceutical product, most commonly formulated as a nasal solution, and has been used in that setting since the 1990s. Outside that jurisdiction it is generally handled as a research chemical rather than an approved medicine. Regulatory status therefore differs sharply between countries, and material sold internationally may not correspond to the Russian pharmaceutical formulation. Documentation with commercial samples is typically limited to a certificate of analysis covering purity and identity, not clinical status or local legal classification.
Verification of a supplied batch generally combines a certificate of analysis with independent testing, because certificates are self-reported documents. A typical package includes a chromatographic trace, a mass spectrum, and a stated water or counter-ion content. Batch-to-batch consistency matters more than a single purity figure when results are compared across experiments. No single mandatory standard governs research-grade peptide release, so laboratories are expected to define their own acceptance criteria. Residual trifluoroacetate from purification is a frequently overlooked counter-ion.
Lyophilized material is chemically stable for extended periods when kept dry, cold, and protected from light. The powder is hygroscopic, so vials should be warmed to room temperature before opening to reduce condensation on the contents. Once dissolved, the peptide is far less stable because peptide bonds are susceptible to hydrolysis and the methionine residue can oxidize. Solutions are typically aliquoted and held at 2-8 °C for short intervals or frozen for longer ones, and repeated freeze-thaw cycles should be avoided.
Semax is a synthetic heptapeptide with the sequence Met-Glu-His-Phe-Pro-Gly-Pro. It is described in the literature as an analogue of the ACTH(4–10) fragment, a short N-terminal portion of adrenocorticotropic hormone that retains some neurotropic activity without the full hormonal effects of the parent peptide. The molecule carries a methionine residue at the N-terminus and two proline residues near the C-terminus, features that shape both its interactions with receptor systems and its chemical stability. The free peptide corresponds to the formula C37H51N9O10S and a molecular mass near 813.9 Da.
The compound was developed in the 1980s at the Institute of Molecular Genetics in Moscow, where it emerged from research on short ACTH fragments and their effects on the central nervous system. Russian pharmaceutical listings describe it as a nootropic and neuroprotective agent, most often formulated as nasal drops. It is not a marketed medicine in the United States or the European Union, and no pharmacopoeial monograph covers it. Consequently, most published clinical experience with the substance originates from a small number of research centres, mainly in Russia and neighbouring countries.
=== Polyadenylation === Based on software analysis of the mRNA sequences various polyadenylation patterns could be identified for the transcription variants . TV1 and TV2 share the same pattern located on exon 10 starting at position 1246 resulting in a 32 nucleotide motif (AGUAGAGUCUGCGCUGUGACCUUCUGUUGGGC). TV3 uses a motif on exon 11 at the position 320. The motif is also 32 nucleotides long, but differs from the sequence used by TV1/2 (AGUGGCUUGUUCCACCUCAGCUCCCAUCUAAC). The difference in the polyadenylation sequence results in a variance of the minimum free energy values of the predicted RNA folding structures (-28.70 kcal/mol, TV1 and TV2 and -16.03 kcal/mol, TV3), which could result in different length of the Poly-A tail. Based on the observation that stable secondary structures result in decreased polyadenylation of the specific site, this might indicate that TV1 and TV2 are less polyadenylated in comparison to TV3.
== Contraindications == Contraindications of spironolactone include hyperkalemia (high potassium levels), severe and end-stage kidney disease (due to high hyperkalemia risk, except possibly in those on dialysis), Addison's disease (adrenal insufficiency and low aldosterone levels), and concomitant use of eplerenone. It should also be used with caution in people with certain neurological disorders, as well as those who experience or have experienced anuria (lack of urine production), acute kidney injury, or significant impairment of kidney excretory function with risk of hyperkalemia.
=== 2 May === Russian Defence Minister Sergei Shoigu said that Russian success in Ukraine would "largely depend on the timely replenishment of weapons". He said that the Russian army had the weapons that it needed for 2023, nevertheless he asked a rocket producer to double its manufacture of precision missiles.
== Definitions == Translational research is aimed at solving particular problems; the term has been used most commonly in life sciences and biotechnology, but applies across the spectrum of science and humanities. In the field of education, it is defined for school-based education by the Education Futures Collaboration (www.meshguides.org) as research which translates concepts to classroom practice. Examples of translational research are commonly found in education subject association journals and in the MESHGuides which have been designed for this purpose. In bioscience, translational research is a term often used interchangeably with translational medicine or translational science or bench to bedside. The adjective "translational" refers to the "translation" (the term derives from the Latin for "carrying over") of basic scientific findings in a laboratory setting into potential treatments for disease. Biomedical translational research adopts a scientific investigation/enquiry into a given problem facing medical/health practices: it aims to "translate" findings in fundamental research into practice. In the field of biomedicine, it is often called "translational medicine", defined by the European Society for Translational Medicine (EUSTM) as "an interdisciplinary branch of the biomedical field supported by three main pillars: benchside, bedside and community", from laboratory experiments through clinical trials, to therapies, to point-of-care patient applications.
=== Reproduction === Salvia divinorum produces few viable seeds even when it does flower—no seeds have ever been observed on plants in the wild. For an unknown reason, pollen fertility is also comparatively reduced. There is no active pollen tube inhibition within the style, but some event or process after the pollen tube reaches the ovary is aberrant. The likeliest explanations are inbreeding depression or hybridity, although the latter was rejected in 2010. All of the Mazatec populations appear to be clonal. The plant's square stems break easily and tend to trail on the ground, rooting easily at the nodes and internodes.
Sources: en.wikipedia.org
=== Isolation === Techniques for cell isolation depend on the cell source. Centrifugation and apheresis are techniques used for extracting cells from biofluids (e.g., blood). Whereas digestion processes, typically using enzymes to remove the extracellular matrix (ECM), are required prior to centrifugation or apheresis techniques to extract cells from tissues/organs. Trypsin and collagenase are the most common enzymes used for tissue digestion. While trypsin is temperature dependent, collagenase is less sensitive to changes in temperature.
== Bibliography == Romualdo Verzosa Jr., ed. (1993). Encyclopedia of Chemical Technology, volume 6 (4th ed.). John Wiley & Sons. ISBN 978-0-471-52674-2. Masters, K (1991). Spray Drying Handbook (5th ed.). Longman Scientific & Technical. ISBN 978-0-582-06266-5. John J. McKetta, ed. (1995). Encyclopedia of Chemical Processing and Design. Marcel Dekker Inc. ISBN 978-0-8247-2604-1.
Algae are used as foods in many countries: China consumes more than 70 species, including fat choy, a cyanobacterium considered a vegetable; Japan, over 20 species such as nori and aonori; Ireland, dulse; Chile, cochayuyo. Laver is used to make laverbread in Wales, where it is known as bara lawr. In Korea, green laver is used to make gim. Some of the most commonly used microalgae as food are:
Embalming is the art and science of preserving human remains by treating them with embalming chemicals in modern times to forestall decomposition. This is usually done to make the deceased suitable for viewing as part of the funeral ceremony or keep them preserved for medical purposes in an anatomical laboratory. The three goals of embalming are sanitization, presentation, and preservation, with restoration being an important additional factor in some instances. Performed successfully, embalming can help preserve the body for many years. Embalming has a long, cross-cultural history, with many cultures giving the embalming processes religious meaning. Animal remains can also be embalmed by similar methods, though embalming is distinct from taxidermy. Embalming preserves the body while keeping it intact, whereas taxidermy is the recreation of an animal's form often using only the creature's skin, fur or feathers mounted on an anatomical form.
Sources: en.wikipedia.org
The sequence is Met-Glu-His-Phe-Pro-Gly-Pro, a seven-residue peptide. The first four residues correspond to the ACTH(4-10) fragment, and Pro-Gly-Pro is added at the C-terminus. N-acetylated versions also appear in the literature and differ in mass.
Semax is a synthetic analog of the ACTH(4-10) fragment rather than a copy of the full hormone. Truncation plus the added tail removes the steroidogenic portion of ACTH. That distinction explains why it is studied for nervous-system effects instead of adrenal stimulation.
It is registered as a prescription product in Russia and has been used there clinically, chiefly by the intranasal route. No approval exists in the United States or the European Union. Availability elsewhere typically falls under research-chemical distribution, with varying purity documentation.
It consists mainly of animal experiments and small clinical reports, with much of the clinical material published in Russian-language journals. Large independent trials are scarce. Separating reliable effects from chance findings is consequently difficult.